header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050727-1
Morpholino Name: MO1-invs
Target: invs (1)
Previous Names: inv-MO (1), invs-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGACATAAGTACCTTCTCCATGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice-blocking morpholino targeting the inversin gene.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-invs No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-invs
Expressed Gene Anatomy Figures
dharma Fig. 5 from Simons et al., 2005
invs Fig. 5 from Simons et al., 2005
PHENOTYPE
Phenotype resulting from MO1-invs
Phenotype of all Fish created by or utilizing MO1-invs
Genome Resources:
CITATIONS (4)