Morpholino

MO2-efnb2a

ID

ZDB-MRPHLNO-050712-3

Name

MO2-efnb2a

Previous Names

efnb2a MO (1)

Target

efnb2a (2)

Sequence

5' - AATATCTCCACAAAGAGTCGCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-efnb2a

Expressed Gene	Anatomy	Figures
efnb2a	(not) somite	Fig. 5 from Jülich et al., 2009

Phenotype

Phenotype resulting from MO2-efnb2a

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	sd2Tg + MO2-efnb2a	Fig. 3 from Pickart et al., 2006

Phenotype of all Fish created by or utilizing MO2-efnb2a

Phenotype	Fish	Conditions	Figures
blood circulation disrupted, abnormal	sd2Tg + MO2-efnb2a	standard conditions	Fig. 3 from Pickart et al., 2006
somite border malformed, abnormal	itga5^tbfe1/tbfe1 + MO2-efnb2a	standard conditions	Fig. 5 from Lackner et al., 2013
somite border malformed, abnormal	itga5^tbfe2/tbfe2 + MO2-efnb2a	standard conditions	Fig. 5 from Lackner et al., 2013
rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
rhombomere 3 deformed, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
rhombomere 5 deformed, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
post-vent vasculature malformed, abnormal	y1Tg + MO1-rasa1a + MO2-efnb2a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal	y1Tg + MO1-rasa1a + MO2-efnb2a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal	y1Tg + MO1-rasa1a + MO2-efnb2a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal	y1Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal	y1Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal	y1Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal	y1Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal	y1Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal	y1Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 3 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal	sd2Tg; y1Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. S6 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal	sd2Tg; y1Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. S6 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO2-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
post-vent vasculature malformed, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
post-vent region blood circulation absent, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
caudal vein plexus malformed, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014
caudal vein plexus increased size, abnormal	y1Tg; zf520Tg + MO2-efnb2a + MO3-ephb4a	standard conditions	Fig. 5 from Kawasaki et al., 2014

Citations