ZFIN ID: ZDB-MRPHLNO-050711-1
Morpholino Name: MO1-hspa9
Target: hspa9 (1)
Previous Name: MO1-hspa9b (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGCCGTTCTCGACACAGACAACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino targeting the hspa9 gene.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hspa9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hspa9 No data available
PHENOTYPE
Phenotype resulting from MO1-hspa9
No data available

Phenotype of all Fish created by or utilizing MO1-hspa9
No data available
OTHER MO1-hspa9 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)