header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050620-2
Morpholino Name: MO1-fn1a
Target: fn1a (1)
Previous Name: MO1-fn1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTTTTCACAGGTGCGATTGAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fn1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fn1a No data available
PHENOTYPE
Phenotype resulting from MO1-fn1a
Phenotype of all Fish created by or utilizing MO1-fn1a
Phenotype Fish Conditions Figures
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 standard conditions Fig. S6 with image from Hu et al., 2018
lateral rectus tissue regeneration decreased efficacy, abnormal zf13Tg + MO1-fn1a ablation: lateral rectus Fig. 6 with image from Louie et al., 2017
lateral rectus tissue regeneration delayed, abnormal zf13Tg + MO1-fn1a ablation: lateral rectus Fig. 6 with image from Louie et al., 2017
pharyngeal arch 1 decreased length, abnormal s1pr1ko311/ko311 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
pharyngeal arch 1 decreased length, abnormal s1pr2ko322/ko322 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
ventral mandibular arch disorganized, abnormal s1pr2ko322/ko322 + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
myotome myosin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Snow et al., 2008
myotome muscle tendon junction morphology, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image from Snow et al., 2008
somite shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament increased length, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with image from Snow et al., 2008
myotome variant shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with imageFig. 2 with image from Snow et al., 2008
somite border aplastic, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
skeletal muscle fiber development disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with image from Snow et al., 2008
somitogenesis disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 4 with image from Snow et al., 2008
somite border shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with imageFig. 2 with image from Snow et al., 2008
myotome increased size, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with imageFig. S6 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO4-tp53 + MO5-lama1 standard conditions Fig. S6 with image from Hu et al., 2018
cardioblast migration to the midline involved in heart rudiment formation disrupted, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
heart rudiment increased amount, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
heart primordium mislocalised laterally, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
cardioblast migration to the midline involved in heart rudiment formation absent, abnormal s1pr2ko322/ko322; ko07Tg + MO1-fn1a standard conditions Fig. 3 with image from Hisano et al., 2013
endoderm increased width, ameliorated gpc4fr6/fr6 ; ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with image from Hu et al., 2018
OTHER MO1-fn1a MORPHOLINO PAGESNo links to external sites
CITATIONS (12)