header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050603-1
Morpholino Name: MO1-nfe2l2a
Target: nfe2l2a (1)
Previous Name: MO1-nfe2l2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATTTCAATCTCCATCATGTCTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Morpholino sequence provided by authors.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nfe2l2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nfe2l2a
Expressed Gene Anatomy Figures
abcc2 Fig. 1 with image from Nakajima et al., 2011
atf3 Fig. 6 from Timme-Laragy et al., 2012
bcat1 Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
blvra Fig. 3Fig. 5 from Holowiecki et al., 2017
blvrb Fig. 3Fig. 5 from Holowiecki et al., 2017
ccng1 Fig. 8 from Timme-Laragy et al., 2012
chmp2a Fig. 1 with image from Nakajima et al., 2011
cpa5 Fig. 4 with image from Zhang et al., 2014
ctrb1 Fig. S2 with image from Zhang et al., 2014
ctrl Fig. S2 with image from Zhang et al., 2014
cx32.3 Fig. 1 with image from Nakajima et al., 2011
ela2l Fig. S2 with image from Zhang et al., 2014
gclc Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
gclm Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
gsta.1 Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
gstp1 Fig. 1 with imageFig. 3 with imageFig. S9 with image from Mukaigasa et al., 2018
Fig. 2 from Onyiah et al., 2013
Fig. 6 from Timme-Laragy et al., 2012
Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
Fig. 1 from Kobayashi et al., 2009
Fig. 2 from Suzuki et al., 2005
gstp2 Fig. 2 from Suzuki et al., 2005
hmox1a Fig. 1 with image from Mukaigasa et al., 2018
Fig. 4Fig. 5 from Holowiecki et al., 2017
Fig. 2 from Onyiah et al., 2013
Fig. 8 from Timme-Laragy et al., 2012
Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
hsp70l Fig. 6 from Timme-Laragy et al., 2012
mgst3b Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
mitfa Fig. 6 from Timme-Laragy et al., 2012
prdx1 Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
prss1 Fig. S2 with image from Zhang et al., 2014
prss59.1 Fig. S2 with image from Zhang et al., 2014
selenow2b Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
tcnbb Fig. 1 with image from Nakajima et al., 2011
tp53 Fig. 8 from Timme-Laragy et al., 2012
txnrd3 Fig. 1 with image from Nakajima et al., 2011
ugdh Fig. 1 with image from Nakajima et al., 2011
fthl27 Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
zgc:163022 Fig. 1 with imageFig. 2 with image from Nakajima et al., 2011
PHENOTYPE
Phenotype resulting from MO1-nfe2l2a
Phenotype of all Fish created by or utilizing MO1-nfe2l2a
Phenotype Fish Conditions Figures
gill gstp1 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: thapsigargin Fig. 3 with image from Mukaigasa et al., 2018
gill gstp1 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: tunicamycin Fig. 3 with image from Mukaigasa et al., 2018
whole organism blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
caudal hematopoietic tissue blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
liver hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-nfe2l2a control Fig. 5 from Holowiecki et al., 2017
glutathione oxidoreductase activity increased occurrence, exacerbated TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
glutathione oxidoreductase activity increased occurrence, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4Fig. 6 from Sant et al., 2017
whole organism hmox1b expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
anatomical structure glutathione decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Sant et al., 2017
heart blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4Fig. 6 from Sant et al., 2017
whole organism hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
whole organism hmox1a expression decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Holowiecki et al., 2017
liver blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
whole organism decreased life span, abnormal WT + MO1-nfe2l2a chemical treatment: pharmaceutical Fig. 4 with image from Cox et al., 2014
liver hmox1a expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
gill gstp1 expression increased amount, abnormal pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. S9 with image from Mukaigasa et al., 2018
gill gstp1 expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
OTHER MO1-nfe2l2a MORPHOLINO PAGESNo links to external sites
CITATIONS (19)