header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050527-2
Morpholino Name: MO4-tal1
Target: tal1 (1)
Previous Names: SclMO (1), scl E2/IMO (1), scl spliceMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATGCTCTTACCATCGTTGATTTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets exon/intron boundary sequence of exon 3/intron 3.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-tal1
Expressed Gene Anatomy Figures
alas2 text only from Patterson et al., 2005
desma Fig. 3 from Patterson et al., 2005
dlc Fig. 6 from Patterson et al., 2005
drl Fig. 4Fig. 5 from Patterson et al., 2005
efnb2a Fig. 6 from Patterson et al., 2005
ephb4a Fig. 6 from Patterson et al., 2005
fli1a Fig. 4Fig. 5Fig. 6 from Patterson et al., 2005
flt4 Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 6 from Patterson et al., 2005
gata1a Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 2Fig. 3Fig. 4 from Patterson et al., 2005
gata2a Fig. 4 from Patterson et al., 2005
gata4 Fig. 4 with image from Peterkin et al., 2009
gata5 Fig. 4 with image from Peterkin et al., 2009
gata6 Fig. 4 with image from Peterkin et al., 2009
hbae3 Fig. 5 with image from Glenn et al., 2014
hbbe1.1 Fig. 2 from Patterson et al., 2005
hhex Fig. 4Fig. 5 from Patterson et al., 2005
ikzf1 Fig. 2 from Patterson et al., 2005
kdrl Fig. 4 with image from Liu et al., 2008
Fig. 6 from Patterson et al., 2005
klf17 Fig. 4 from Patterson et al., 2005
lcp1 Fig. 2 from Patterson et al., 2005
lmo2 Fig. 4Fig. 5 from Patterson et al., 2005
mpx Fig. 5 with image from Glenn et al., 2014
Fig. 2 from Patterson et al., 2005
mybl2a Fig. 2 from Patterson et al., 2005
nkx2.4b Fig. 2 with imagetext only from Alt et al., 2006
nkx2.5 Fig. 3 from Patterson et al., 2005
notch3 Fig. 6 from Patterson et al., 2005
npas4l Fig. 4 from Reischauer et al., 2016
pax2a Fig. 3 from Patterson et al., 2005
runx1 Fig. 2Fig. 4 from Patterson et al., 2005
sox7 Fig. 2 from Cermenati et al., 2008
sox18 Fig. 2 from Cermenati et al., 2008
spi1b Fig. 4 with image from Peterkin et al., 2009
Fig. 6Fig. 7 from Patterson et al., 2007
Fig. 2Fig. 3Fig. 5 from Patterson et al., 2005
tbx20 Fig. 6 from Patterson et al., 2005
tek Fig. 6 from Patterson et al., 2005
tie1 Fig. 2 with image from Alt et al., 2006
Fig. 6 from Patterson et al., 2005
PHENOTYPE
Phenotype resulting from MO4-tal1
Phenotype of all Fish created by or utilizing MO4-tal1
OTHER MO4-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (16)