header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050527-1
Morpholino Name: MO3-tal1
Target: tal1 (1)
Previous Names: scl atgMO (1), zfSCL MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTCAGTTTTTCCATCATCCTTCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the start site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tal1
Expressed Gene Anatomy Figures
gata1a Fig. 8 from Peterkin et al., 2003
myh7 Fig. 8 from Peterkin et al., 2003
PHENOTYPE
Phenotype resulting from MO3-tal1
No data available

Phenotype of all Fish created by or utilizing MO3-tal1
No data available
OTHER MO3-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (2)