ZFIN ID: ZDB-MRPHLNO-050524-1
Morpholino Name: MO6-neurog1
Target: neurog1 (1)
Previous Name: ngn-1MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGATCTCCATTGTTGATAACCTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino targeting the neurog1 gene.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-neurog1
Expressed Gene Anatomy Figures
p2rx3a Fig. S4 with image from Caron et al., 2008
p2rx3b Fig. 7 with image from Caron et al., 2008
trpa1b Fig. 7 with image from Caron et al., 2008
trpv1 Fig. S4 with image from Caron et al., 2008
PHENOTYPE
Phenotype resulting from MO6-neurog1
No data available

Phenotype of all Fish created by or utilizing MO6-neurog1
Phenotype Fish Conditions Figures
axon regeneration disrupted, abnormal WT + MO6-neurog1 ablation: axon: trigeminal ganglion Fig. 4 with image from O'Brien et al., 2009
OTHER MO6-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)