Morpholino

MO1-boc

ID

ZDB-MRPHLNO-050517-1

Name

MO1-boc

Previous Names

None

Target

boc (1)

Sequence

5' - AATCCAATTCAACGTCCCAGACATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-boc

Expressed Gene	Anatomy	Figures
nkx2.2a	forebrain ventral region	Fig. 4 from Bergeron et al., 2011

Phenotype

Phenotype resulting from MO1-boc

Phenotype	Fish	Figures
axon extension involved in axon guidance process quality, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011
axon guidance disrupted, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
caudal commissure defasciculated, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
caudal commissure axon mislocalised, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
cranial nerve II misrouted, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011
dorsal/ventral axon guidance disrupted, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
dorsoventral diencephalic tract morphology, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
forebrain physical object quality, abnormal	vu17Tg + MO1-boc	Fig. 6 from Bergeron et al., 2011
forebrain development disrupted, abnormal	WT + MO1-boc	Fig. 5 from Connor et al., 2005
forebrain development process quality, abnormal	vu17Tg + MO1-boc	Fig. 6 from Bergeron et al., 2011
lateral floor plate physical object quality, abnormal	vu17Tg + MO1-boc	Fig. 6 from Bergeron et al., 2011
midbrain ventral region physical object quality, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011
post-vent region curved ventral, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011
regulation of smoothened signaling pathway process quality, abnormal	vu17Tg + MO1-boc	Fig. 6 from Bergeron et al., 2011
retinal ganglion cell axon guidance process quality, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011
spinal cord dorsal/ventral patterning process quality, abnormal	vu17Tg + MO1-boc	Fig. 6 from Bergeron et al., 2011
trunk curved ventral, abnormal	WT + MO1-boc	Fig. 4 from Bergeron et al., 2011

Phenotype of all Fish created by or utilizing MO1-boc

Phenotype	Fish	Conditions	Figures
post-vent region curved ventral, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
dorsoventral diencephalic tract morphology, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
caudal commissure axon mislocalised, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
forebrain development disrupted, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
trunk curved ventral, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
axon guidance disrupted, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
dorsal/ventral axon guidance disrupted, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
caudal commissure defasciculated, abnormal	WT + MO1-boc	standard conditions	Fig. 5 from Connor et al., 2005
axon extension involved in axon guidance process quality, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
cranial nerve II misrouted, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
retinal ganglion cell axon guidance process quality, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
midbrain ventral region physical object quality, abnormal	WT + MO1-boc	standard conditions	Fig. 4 from Bergeron et al., 2011
regulation of smoothened signaling pathway process quality, abnormal	vu17Tg + MO1-boc	standard conditions	Fig. 6 from Bergeron et al., 2011
spinal cord dorsal/ventral patterning process quality, abnormal	vu17Tg + MO1-boc	standard conditions	Fig. 6 from Bergeron et al., 2011
forebrain physical object quality, abnormal	vu17Tg + MO1-boc	standard conditions	Fig. 6 from Bergeron et al., 2011
lateral floor plate physical object quality, abnormal	vu17Tg + MO1-boc	standard conditions	Fig. 6 from Bergeron et al., 2011
forebrain development process quality, abnormal	vu17Tg + MO1-boc	standard conditions	Fig. 6 from Bergeron et al., 2011

Citations