ZFIN ID: ZDB-MRPHLNO-050508-3
Morpholino Name: MO3-pitx3
Target: pitx3 (1)
Sequence:
5' - AGGTTAAAATCCATCACCTCTACCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pitx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pitx3
Expressed Gene Anatomy Figures
lhx3 Fig. 5 with image from Dutta et al., 2005
mipa Fig. 7 with image from Sorokina et al., 2011
nkx2.2a Fig. 5 with image from Dutta et al., 2005
pitx3 Fig. 6 with image from Dutta et al., 2005
pomca Fig. 5 with image from Dutta et al., 2005
PHENOTYPE
Phenotype resulting from MO3-pitx3
Phenotype Figures
eye lacks all parts of type lens, abnormal text only from Sorokina et al., 2011
head decreased size, abnormal Fig. 5 with image from Sorokina et al., 2011
head deformed, abnormal text only from Sorokina et al., 2011
lens decreased size, abnormal Fig. 5 with image from Sorokina et al., 2011
lens development in camera-type eye disrupted, abnormal Fig. 5 with image from Sorokina et al., 2011
mandibular arch skeleton morphology, abnormal text only from Sorokina et al., 2011

Phenotype of all Fish created by or utilizing MO3-pitx3
Phenotype Fish Conditions Figures
eye lacks all parts of type lens, abnormal WT + MO3-pitx3 standard conditions text only from Sorokina et al., 2011
lens development in camera-type eye disrupted, abnormal WT + MO3-pitx3 standard conditions Fig. 5 with image from Sorokina et al., 2011
lens decreased size, abnormal WT + MO3-pitx3 standard conditions Fig. 5 with image from Sorokina et al., 2011
head decreased size, abnormal WT + MO3-pitx3 standard conditions Fig. 5 with image from Sorokina et al., 2011
mandibular arch skeleton morphology, abnormal WT + MO3-pitx3 standard conditions text only from Sorokina et al., 2011
head deformed, abnormal WT + MO3-pitx3 standard conditions text only from Sorokina et al., 2011
OTHER MO3-pitx3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)