header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050508-3
Morpholino Name: MO3-pitx3
Target: pitx3 (1)
Sequence:
5' - AGGTTAAAATCCATCACCTCTACCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pitx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pitx3
Expressed Gene Anatomy Figures
lhx3 Fig. 5 with image from Dutta et al., 2005
mipa Fig. 7 with image from Sorokina et al., 2011
nkx2.2a Fig. 5 with image from Dutta et al., 2005
pitx3 Fig. 6 with image from Dutta et al., 2005
pomca Fig. 5 with image from Dutta et al., 2005
PHENOTYPE
Phenotype resulting from MO3-pitx3
Phenotype of all Fish created by or utilizing MO3-pitx3
OTHER MO3-pitx3 MORPHOLINO PAGES No links to external sites
CITATIONS (2)