Morpholino

MO2-ift88

ID
ZDB-MRPHLNO-050506-2
Name
MO2-ift88
Previous Names
  • MO2-ttc10 (1)
  • polarisSP (1)
Target
Sequence
5' - AGCAGATGCAAAATGACTCACTGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino targeting the ift88 gene.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ift88
Expressed Gene Anatomy Figures
pax2a Fig. 8 with image from Gerlach et al., 2014
podxl Fig. 8 with image from Gerlach et al., 2014
wt1a Fig. 8 with image from Gerlach et al., 2014
Phenotype
Phenotype resulting from MO2-ift88
Phenotype Fish Figures
cell migration arrested, abnormal sqet33D10Et + MO2-ift88 (AB) Fig. 7 with image from Vasilyev et al., 2009
cilium assembly process quality, abnormal AB + MO2-ift88 Fig. 5 with image from Oltrabella et al., 2015
pericardium edematous, abnormal AB + MO2-ift88 Fig. 5 with image from Oltrabella et al., 2015
pronephros cystic, abnormal AB + MO2-ift88 Fig. 5 with image from Oltrabella et al., 2015
pronephros epithelial cilium movement involved in extracellular fluid movement arrested, abnormal TU + MO2-ift88 Fig. 8 with image from Gerlach et al., 2014
pronephros renal absorption decreased process quality, abnormal AB + MO2-ift88 Fig. 5 with image,  Fig. 7 with image from Oltrabella et al., 2015
proximal convoluted tubule development arrested, abnormal sqet33D10Et + MO2-ift88 (AB) Fig. 7 with image from Vasilyev et al., 2009
renal tubule dilated, abnormal AB + MO2-ift88 Fig. 5 with image from Oltrabella et al., 2015
whole organism anterior-posterior axis curved, abnormal AB + MO2-ift88 Fig. 5 with image from Oltrabella et al., 2015
Phenotype of all Fish created by or utilizing MO2-ift88
Phenotype Fish Conditions Figures
renal tubule dilated, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image from Oltrabella et al., 2015
whole organism anterior-posterior axis curved, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image from Oltrabella et al., 2015
cilium assembly process quality, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image from Oltrabella et al., 2015
pericardium edematous, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image from Oltrabella et al., 2015
pronephros cystic, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image from Oltrabella et al., 2015
pronephros renal absorption decreased process quality, abnormal AB + MO2-ift88 standard conditions Fig. 5 with image,  Fig. 7 with image from Oltrabella et al., 2015
pronephros epithelial cilium movement involved in extracellular fluid movement arrested, abnormal TU + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
proximal convoluted tubule development arrested, abnormal sqet33D10Et + MO2-ift88 (AB) standard conditions Fig. 7 with image from Vasilyev et al., 2009
cell migration arrested, abnormal sqet33D10Et + MO2-ift88 (AB) standard conditions Fig. 7 with image from Vasilyev et al., 2009
heart contraction arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
pronephros epithelial cilium movement involved in extracellular fluid movement arrested, abnormal TU + MO1-tnnt2a + MO2-ift88 standard conditions Fig. 8 with image from Gerlach et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.