Morpholino

MO2-prdm1a

ID
ZDB-MRPHLNO-050429-1
Name
MO2-prdm1a
Previous Names
  • E2I2 prdm1-MO (1)
  • MO2-prdm1
Target
Sequence
5' - TGGTGTCATACCTCTTTGGAGTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
exon 2 - intron 2 splice-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prdm1a
Expressed Gene Anatomy Figures
crestin Fig. 2 with image from Hernandez-Lagunas et al., 2005
dlx2a Fig. 3 from LaMonica et al., 2015
Fig. 8 with image from Lee et al., 2006
elavl3 Fig. 2 with image from Hernandez-Lagunas et al., 2005
fgf8a Fig. 8 with image from Lee et al., 2006
fgf10a Fig. 6 with image from Lee et al., 2006
fgf24 Fig. 5 with image from Lee et al., 2006
foxd3 Fig. 2 with image from Hernandez-Lagunas et al., 2005
isl1a Fig. 6 with image from Liu et al., 2012
isl2a Fig. 6 with image from Liu et al., 2012
mnx1 Fig. 6 with image from Liu et al., 2012
mylpfa Fig. 5 with image from Liew et al., 2008
shha Fig. 7 with image from Lee et al., 2006
tbx5a Fig. 5 with image from Lee et al., 2006
Phenotype
Phenotype resulting from MO2-prdm1a
Phenotype Fish Figures
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
ceratohyal cartilage inverted, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
cleithrum decreased size, abnormal WT + MO2-prdm1a Fig. 3 with image from Lee et al., 2006
developmental growth decreased rate, abnormal WT + MO2-prdm1a Fig. 6 from Kamei et al., 2018
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
neurocranium decreased width, abnormal WT + MO2-prdm1a Fig. 4 with image from Ding et al., 2013
pectoral fin bud hypoplastic, abnormal WT + MO2-prdm1a Fig. 3 with image from Lee et al., 2006
pectoral fin skeleton aplastic, abnormal WT + MO2-prdm1a Fig. 3 with image from Lee et al., 2006
pharyngeal arch 3 decreased object quality, abnormal AB + MO2-prdm1a Fig. 3 from LaMonica et al., 2015
pharyngeal arch 4 decreased object quality, abnormal AB + MO2-prdm1a Fig. 3 from LaMonica et al., 2015
pharyngeal arch cartilage has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-prdm1a Fig. 3 from LaMonica et al., 2015
Phenotype of all Fish created by or utilizing MO2-prdm1a
Phenotype Fish Conditions Figures
pharyngeal arch 3 decreased object quality, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
pharyngeal arch 4 decreased object quality, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
pharyngeal arch cartilage has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
neurocranium decreased width, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
developmental growth decreased rate, abnormal WT + MO2-prdm1a control Fig. 6 from Kamei et al., 2018
developmental growth decreased rate, abnormal WT + MO2-prdm1a oxygen content, hypoxia Fig. 6 from Kamei et al., 2018
neurocranial trabecula shortened, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
pectoral fin skeleton aplastic, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
pectoral fin bud hypoplastic, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
developmental growth decreased rate, abnormal WT + MO2-prdm1a hypoxia Fig. 6 from Kamei et al., 2018
cleithrum decreased size, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
ceratohyal cartilage inverted, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Meckel's cartilage shortened, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Meckel's cartilage shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.