Morpholino

MO1-wnt4

ID
ZDB-MRPHLNO-050318-1
Name
MO1-wnt4
Previous Names
  • MO1-wnt4a
  • wnt4-MO (1)
Target
Sequence
5' - CTCCGATGACATCTTTAGTGGAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the translation initiation site of wnt4a.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt4
Expressed Gene Anatomy Figures
eaf1 Fig. 1 with image from Wan et al., 2010
eaf2 Fig. 1 with image from Wan et al., 2010
Phenotype
Phenotype resulting from MO1-wnt4
Phenotype of all Fish created by or utilizing MO1-wnt4
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
habenular commissure aplastic, abnormal WT + MO1-wnt4 standard conditions Fig. 7 with image from Hendricks et al., 2008
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
eye fused with eye, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
neural tube formation disrupted, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
post-vent region bent, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
whole organism decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
brain morphology, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
extension decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
extension increased width, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
post-vent region decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
Citations