ZFIN ID: ZDB-MRPHLNO-050308-8
Morpholino Name: MO2-sufu
Target: sufu (1)
Previous Name: Su(fu) MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCCGCATCTCATCCATCCCGCACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino that targets sufu.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sufu No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sufu
Expressed Gene Anatomy Figures
ptch2 Fig. 7 from Wolff et al., 2003
PHENOTYPE
Phenotype resulting from MO2-sufu
Phenotype of all Fish created by or utilizing MO2-sufu
Phenotype Fish Conditions Figures
slow muscle cell increased amount, abnormal WT + MO1-sufu + MO2-sufu standard conditions Fig. ST2 from Flynt et al., 2007
regenerating tissue Muller cell increased amount, abnormal WT + MO2-sufu perforation: retina Fig. 1 with image from Kaur et al., 2018
Muller cell cell dedifferentiation increased occurrence, abnormal WT + MO2-sufu perforation: retina Fig. 1 with image from Kaur et al., 2018
regenerating tissue retina mmp9 expression decreased amount, abnormal WT + MO2-sufu perforation: retina Fig. 4 with image from Kaur et al., 2018
regenerating tissue retina lin28a expression increased amount, abnormal WT + MO2-sufu perforation: retina Fig. 3 with image from Kaur et al., 2018
regenerating tissue retina Ab3-ascl1 labeling increased amount, abnormal WT + MO2-sufu perforation: retina Fig. 4 with image from Kaur et al., 2018
regulation of smoothened signaling pathway disrupted, abnormal WT + MO2-sufu standard conditions Fig. 7 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO2-sufu standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO2-sufu standard conditions Fig. 7 from Wolff et al., 2003
regenerating tissue retina ascl1a expression increased amount, abnormal WT + MO2-sufu perforation: retina Fig. 2 with image from Kaur et al., 2018
regenerating tissue retina zic2b expression increased amount, abnormal WT + MO2-sufu perforation: retina Fig. 5 with image from Kaur et al., 2018
myotome fast muscle cell increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
myotome muscle pioneer increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
slow muscle cell disorganized, abnormal WT + MO1-mir214a + MO1-sufu + MO2-sufu standard conditions Fig. 4 from Flynt et al., 2007
Genome Resources:
CITATIONS (4)