ZFIN ID: ZDB-MRPHLNO-050308-15
Morpholino Name: MO5-neurog1
Target: neurog1 (1)
Sequence:
5' - ATACGATCTCCATTGTTGATAACCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-neurog1
Expressed Gene Anatomy Figures
btbd6a primary neuron Fig. 1 from Sobieszczuk et al., 2010
dla hindbrain Fig. S6 with image from Nikolaou et al., 2009
lfng hindbrain Fig. S6 with image from Nikolaou et al., 2009
rfng hindbrain Fig. 6 with image from Amoyel et al., 2005
PHENOTYPE 
Phenotype resulting from MO5-neurog1
Phenotype Figures
neurogenesis process quality, abnormal Fig. 1 from Sobieszczuk et al., 2010
primary neuron decreased amount, abnormal Fig. 1 from Sobieszczuk et al., 2010

Phenotype of all Fish created by or utilizing MO5-neurog1
Phenotype Fish Conditions Figures
neurogenesis process quality, abnormal WT + MO5-neurog1 standard conditions Fig. 1 from Sobieszczuk et al., 2010
primary neuron decreased amount, abnormal WT + MO5-neurog1 standard conditions Fig. 1 from Sobieszczuk et al., 2010
OTHER MO5-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)