Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-ascl1a

ID
ZDB-MRPHLNO-050308-13
Name
MO3-ascl1a
Previous Names
  • asha MO (1)
Target
Sequence
5' - CCATCTTGGCGGTGATGTCCATTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ascl1a
Phenotype
Phenotype resulting from MO3-ascl1a
Phenotype of all Fish created by or utilizing MO3-ascl1a
Phenotype Fish Conditions Figures
regenerating tissue retina zic2b expression decreased amount, abnormal WT + MO3-ascl1a perforation: retina Fig. 5 with image from Kaur et al., 2018
regenerating tissue retina foxn4 expression decreased amount, abnormal WT + MO3-ascl1a perforation: retina Fig. 6 with image from Kaur et al., 2018
regenerating tissue retina mmp9 expression increased amount, abnormal WT + MO3-ascl1a perforation: retina, chemical treatment: DAPT Fig. 4 with image from Kaur et al., 2018
regenerating tissue retina ascl1a expression increased amount, abnormal WT + MO3-ascl1a perforation: retina, chemical treatment: DAPT Fig. 4 with image from Kaur et al., 2018
regenerating tissue retina mmp9 expression increased amount, abnormal WT + MO3-ascl1a perforation: retina Fig. 4 with image from Kaur et al., 2018
sympathetic ganglion development disrupted, abnormal WT + MO3-ascl1a standard conditions Fig. 7 with image from Pei et al., 2013
regenerating tissue retina Ab3-ascl1 labeling decreased amount, abnormal WT + MO3-ascl1a perforation: retina, chemical treatment: DAPT Fig. 4 with image from Kaur et al., 2018
cell proliferation in hindbrain disrupted, abnormal WT + MO1-ascl1b + MO3-ascl1a standard conditions Fig. 4 with image from Amoyel et al., 2005
neurogenesis disrupted, abnormal WT + MO1-ascl1b + MO3-ascl1a standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain decreased width, abnormal WT + MO1-ascl1b + MO3-ascl1a standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-ascl1b + MO3-ascl1a standard conditions Fig. 4 with image from Amoyel et al., 2005
sympathetic ganglion development disrupted, abnormal WT + MO3-ascl1a + MO3-phox2bb standard conditions Fig. 7 with image from Pei et al., 2013
Citations