Morpholino

MO1-wnt1

ID
ZDB-MRPHLNO-050308-12
Name
MO1-wnt1
Previous Names
None
Target
Sequence
5' - AGCAACGCGAGAACCCGCATGATAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt1
Expressed Gene Anatomy Figures
ascl1b Fig. 4 with image from Amoyel et al., 2005
ccnd1 Fig. 2 with image from Amoyel et al., 2005
cdkn1ca Fig. 4 with image from Amoyel et al., 2005
dbx1a Fig. 5 with image from Amoyel et al., 2005
dla Fig. 4 with image from Amoyel et al., 2005
dld Fig. 4 with image from Amoyel et al., 2005
epha4a Fig. 4 with image from Amoyel et al., 2005
foxb1a Fig. 2 with image from Amoyel et al., 2005
gfap Fig. 5 with image from Amoyel et al., 2005
lmx1ba Fig. 7 with image from Elsen et al., 2008
neurog1 Fig. 4 with image from Amoyel et al., 2005
rfng Fig. 2 with image from Amoyel et al., 2005
tbx20 Fig. 5 with image from Amoyel et al., 2005
zic1 Fig. 6 with image from Elsen et al., 2008
zic4 Fig. 6 with image from Elsen et al., 2008
Phenotype
Phenotype resulting from MO1-wnt1
Phenotype Fish Figures
cell proliferation in hindbrain disrupted, abnormal WT + MO1-wnt1 Fig. 4 with image from Amoyel et al., 2005
cranial nerve IX hypoplastic, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
cranial nerve VI hypoplastic, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
cranial nerve VII hypoplastic, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
cranial nerve X hypoplastic, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
fourth ventricle structure, abnormal AB + MO1-wnt1 Fig. 6 with image from Elsen et al., 2008
fourth ventricle development disrupted, abnormal AB + MO1-wnt1 Fig. 6 with image from Elsen et al., 2008
glial cell mislocalised, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
hindbrain decreased width, abnormal WT + MO1-wnt1 Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-wnt1 Fig. 4 with image from Amoyel et al., 2005
midbrain development disrupted, abnormal WT + MO1-wnt1 + MO4-tp53 Fig. 4 from Ota et al., 2012
motor neuron decreased amount, abnormal WT + MO1-wnt1 Fig. 5 with image from Amoyel et al., 2005
neurogenesis disrupted, abnormal WT + MO1-wnt1 Fig. 4 with image,  Fig. 5 with image from Amoyel et al., 2005
optic tectum decreased size, abnormal WT + MO1-wnt1 + MO4-tp53 Fig. 4 from Ota et al., 2012
Phenotype of all Fish created by or utilizing MO1-wnt1
Phenotype Fish Conditions Figures
fourth ventricle structure, abnormal AB + MO1-wnt1 standard conditions Fig. 6 with image from Elsen et al., 2008
fourth ventricle development disrupted, abnormal AB + MO1-wnt1 standard conditions Fig. 6 with image from Elsen et al., 2008
cranial nerve VII hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cell proliferation in hindbrain disrupted, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
cranial nerve X hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cranial nerve IX hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
motor neuron decreased amount, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
glial cell mislocalised, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cranial nerve VI hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
hindbrain decreased width, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
neurogenesis disrupted, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image,  Fig. 5 with image from Amoyel et al., 2005
optic tectum decreased size, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
midbrain development disrupted, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.