ZFIN ID: ZDB-MRPHLNO-050308-12
Morpholino Name: MO1-wnt1
Target: wnt1 (1)
Sequence:
5' - AGCAACGCGAGAACCCGCATGATAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt1
Expressed Gene Anatomy Figures
ascl1b Fig. 4 with image from Amoyel et al., 2005
ccnd1 Fig. 2 with image from Amoyel et al., 2005
cdkn1ca Fig. 4 with image from Amoyel et al., 2005
dbx1a Fig. 5 with image from Amoyel et al., 2005
dla Fig. 4 with image from Amoyel et al., 2005
dld Fig. 4 with image from Amoyel et al., 2005
epha4a Fig. 4 with image from Amoyel et al., 2005
foxb1a Fig. 2 with image from Amoyel et al., 2005
gfap Fig. 5 with image from Amoyel et al., 2005
lmx1ba Fig. 7 with image from Elsen et al., 2008
neurog1 Fig. 4 with image from Amoyel et al., 2005
rfng Fig. 2 with image from Amoyel et al., 2005
tbx20 Fig. 5 with image from Amoyel et al., 2005
zic1 Fig. 6 with image from Elsen et al., 2008
zic4 Fig. 6 with image from Elsen et al., 2008
PHENOTYPE
Phenotype resulting from MO1-wnt1
Phenotype Figures
cell proliferation in hindbrain disrupted, abnormal Fig. 4 with image from Amoyel et al., 2005
cranial nerve IX hypoplastic, abnormal Fig. 5 with image from Amoyel et al., 2005
cranial nerve VI hypoplastic, abnormal Fig. 5 with image from Amoyel et al., 2005
cranial nerve VII hypoplastic, abnormal Fig. 5 with image from Amoyel et al., 2005
cranial nerve X hypoplastic, abnormal Fig. 5 with image from Amoyel et al., 2005
fourth ventricle structure, abnormal Fig. 6 with image from Elsen et al., 2008
fourth ventricle development disrupted, abnormal Fig. 6 with image from Elsen et al., 2008
glial cell mislocalised, abnormal Fig. 5 with image from Amoyel et al., 2005
hindbrain decreased width, abnormal Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal Fig. 4 with image from Amoyel et al., 2005
midbrain development disrupted, abnormal Fig. 4 from Ota et al., 2012
motor neuron decreased amount, abnormal Fig. 5 with image from Amoyel et al., 2005
neurogenesis disrupted, abnormal Fig. 4 with imageFig. 5 with image from Amoyel et al., 2005
optic tectum decreased size, abnormal Fig. 4 from Ota et al., 2012

Phenotype of all Fish created by or utilizing MO1-wnt1
Phenotype Fish Conditions Figures
fourth ventricle structure, abnormal AB + MO1-wnt1 standard conditions Fig. 6 with image from Elsen et al., 2008
fourth ventricle development disrupted, abnormal AB + MO1-wnt1 standard conditions Fig. 6 with image from Elsen et al., 2008
cranial nerve VII hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cell proliferation in hindbrain disrupted, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
cranial nerve X hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cranial nerve IX hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
motor neuron decreased amount, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
glial cell mislocalised, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
cranial nerve VI hypoplastic, abnormal WT + MO1-wnt1 standard conditions Fig. 5 with image from Amoyel et al., 2005
hindbrain decreased width, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with image from Amoyel et al., 2005
neurogenesis disrupted, abnormal WT + MO1-wnt1 standard conditions Fig. 4 with imageFig. 5 with image from Amoyel et al., 2005
optic tectum decreased size, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
midbrain development disrupted, abnormal WT + MO1-wnt1 + MO4-tp53 standard conditions Fig. 4 from Ota et al., 2012
OTHER MO1-wnt1 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)