ZFIN ID: ZDB-MRPHLNO-050221-4
Morpholino Name: MO1-kita
Target: kita (1)
Previous Names: MO1-kit (1), sparse-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TATAAGTCCATCTATCTCATGTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Effect is a reduced number of melanocytes.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kita No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kita No data available
PHENOTYPE
Phenotype resulting from MO1-kita
No data available

Phenotype of all Fish created by or utilizing MO1-kita
No data available
OTHER MO1-kita MORPHOLINO PAGES
  • MODB:52 (2)
  • CITATIONS (4)