header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050209-5
Morpholino Name: MO1-gli1
Target: gli1 (1)
Previous Names: Gli1-MO (1), zfgli1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGACACACCCGCTACACCCACAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gli1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gli1
Expressed Gene Anatomy Figures
egr2b Fig. 6 with imageFig. 10 with image from Vanderlaan et al., 2005
foxa Fig. 5 with image from Karlstrom et al., 2003
gh1 Fig. 4 with image from Devine et al., 2009
gli1 Fig. 10 with image from Vanderlaan et al., 2005
neurog1 Fig. 6 with imageFig. 7 with image from Ninkovic et al., 2008
nkx2.2a Fig. 5 with image from Devine et al., 2009
Fig. 5 with image from Karlstrom et al., 2003
ntn1a Fig. 6 with image from Vanderlaan et al., 2005
pax2a Fig. 6 with imageFig. 7 with image from Ninkovic et al., 2008
pomca Fig. 4 with image from Devine et al., 2009
prl Fig. 4 with imageFig. 5 with image from Devine et al., 2009
ptch2 Fig. 5 with image from Tyurina et al., 2005
Fig. 10 with image from Vanderlaan et al., 2005
tshba Fig. 4 with image from Devine et al., 2009
PHENOTYPE
Phenotype resulting from MO1-gli1
Phenotype of all Fish created by or utilizing MO1-gli1
OTHER MO1-gli1 MORPHOLINO PAGESNo links to external sites
CITATIONS (12)