ZFIN ID: ZDB-MRPHLNO-050202-2
Morpholino Name: MO2-neurog1
Target: neurog1 (1)
Previous Name: ngn-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCATATCGGAGTATACGATCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-neurog1 No data available
PHENOTYPE 
Phenotype resulting from MO2-neurog1
Phenotype Figures
dorsal root ganglion morphology, abnormal Fig. 6 from McGraw et al., 2008

Phenotype of all Fish created by or utilizing MO2-neurog1
Phenotype Fish Conditions Figures
dorsal root ganglion morphology, abnormal w61Tg + MO2-neurog1 standard conditions Fig. 6 from McGraw et al., 2008
OTHER MO2-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)