header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050119-7
Morpholino Name: MO1-lft2
Target: lft2 (1)
Previous Name: atv2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTGGATGAACAGAGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lft2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lft2
Expressed Gene Anatomy Figures
lft1 Fig. 1 with image from Lenhart et al., 2011
spaw Fig. 1 with image from Lenhart et al., 2011
PHENOTYPE
Phenotype resulting from MO1-lft2
Phenotype of all Fish created by or utilizing MO1-lft2
OTHER MO1-lft2 MORPHOLINO PAGES No links to external sites
CITATIONS (5)