header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041214-2
Morpholino Name: MO1-unc5b
Target: unc5b (1)
Previous Names: MO-unc5b-sb-1 (1), unc5bSBMO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATTTAACCGGCTCGTACCTGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed to prevent correct splicing of the exon encoded by nucleotides 1-215 of the Unc5b 1.4 kb cDNA
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-unc5b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-unc5b No data available
PHENOTYPE
Phenotype resulting from MO1-unc5b
Phenotype of all Fish created by or utilizing MO1-unc5b
OTHER MO1-unc5b MORPHOLINO PAGESNo links to external sites
CITATIONS (4)