ZFIN ID: ZDB-MRPHLNO-041129-3
Morpholino Name: MO1-ihhb
Target: ihhb (1)
Previous Names: ehh-MO (1), ehh-MO-1, MO1-ehh (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGGAGCGCCGCCGCCGTGGAGAGTCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: A translation blocking morpholino targeting ehh.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ihhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ihhb
Expressed Gene Anatomy Figures
alcama Fig. 2 from Chung et al., 2013
ccne1 Fig. 3 from Chung et al., 2013
cdk2 Fig. 3 from Chung et al., 2013
cdkn1ca Fig. 3 from Chung et al., 2013
neurog1 Fig. 3 from Chung et al., 2013
olig2 Fig. 2 from Chung et al., 2013
sox10 Fig. 2Fig. 4 from Chung et al., 2013
PHENOTYPE
Phenotype resulting from MO1-ihhb
Phenotype Figures
glioblast (sensu Vertebrata) cell division increased occurrence, abnormal Fig. 3 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal Fig. 2Fig. 4 from Chung et al., 2013
spinal cord neuron increased amount, abnormal Fig. 3 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal Fig. 2 from Chung et al., 2013
spinal cord regulation of oligodendrocyte progenitor proliferation disrupted, abnormal Fig. 4 from Chung et al., 2013
spinal cord spinal cord oligodendrocyte cell fate specification disrupted, abnormal Fig. 2 from Chung et al., 2013

Phenotype of all Fish created by or utilizing MO1-ihhb
Phenotype Fish Conditions Figures
spinal cord regulation of oligodendrocyte progenitor proliferation disrupted, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord neuron increased amount, abnormal WT + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal ck1Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
glioblast (sensu Vertebrata) cell division increased occurrence, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord spinal cord oligodendrocyte cell fate specification disrupted, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
primary motor neuron decreased amount, abnormal shhaDf(Chr07)t4/t4 + MO1-ihhb + MO1-shhb(AB) standard conditions Fig. 2 with image from Lewis et al., 2001
positive regulation of transcription, DNA-templated disrupted, abnormal shhaDf(Chr07)t4/t4 + MO1-ihhb + MO2-shhb standard conditions Fig. 6 with image from Cheesman et al., 2004
positive regulation of transcription, DNA-templated arrested, abnormal smob641/b641 + MO1-ihhb + MO2-shhb(AB) standard conditions Fig. 6 with image from Cheesman et al., 2004
OTHER MO1-ihhb MORPHOLINO PAGESNo links to external sites
CITATIONS (4)