ZFIN ID: ZDB-EST-090218-32
EST Name: eu1082
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 500
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
5' CAGTGATGTCATTCCTGACG 3'   5' GGATCCATTAACCCTCACTAAAGGGAACTGGCAAGTTTCTGTTTGTG 3'
Quality: Rating 4 ( Nice strong expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (18 images) from Thisse et al., 2005 [eu1082]
MARKER RELATIONSHIPS
eu1082 Is Encoded by: [Gene] slc17a6b (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:DX503551 247bp
OTHER eu1082 EST PAGESNo links to external sites
CITATIONS (1)