header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-090218-105
EST Name: eu2433
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1000
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
5' CATTGACTGAGAATTTGCCTAC 3'
5'GGATCCATTAACCCTCACTAAAGGGAACCTACTGAACGCCAGCTC
Quality: Rating 3 ( Moderate expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (17 images) from Thisse et al., 2005 [eu2433]
MARKER RELATIONSHIPS
eu2433 Is Encoded by: [Gene] gpr161 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:FI495109 748bp
OTHER eu2433 EST PAGESNo links to external sites
CITATIONS (1)