header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-080403-46
EST Name: dq017615
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1000
Cloning Site: EcoRI
Vector Type: Plasmid
Vector: pBS-IIKS
Polymerase: T3 RNA polymerase
PCR Amplification: 5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Source:
Quality: Rating 1 ( Probe is difficult to use. Generally basal level of expression with more intense labeling in particular structure. )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
Note: Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (7 images) from Thisse et al., 2008 [dq017615]
MARKER RELATIONSHIPS
dq017615 Is Encoded by: [Gene] nr3c1 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ017615 940bp
Polypeptide GenPept:AAY85270 (1) 313aa
Select Tool
OTHER dq017615 EST PAGESNo links to external sites
CITATIONS (3)