header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-060130-95
EST Name: eu467
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 740
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer TCCTGTGCTGTTTCTACAGG                reverse_primer GGATCCATTAACCCTCACTAAAGGGAATGCGCAGAACAAGTTATAGG
Quality: Rating 5 ( Simple to use, intense expression pattern restricted to a few structures )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (12 images) from Thisse et al., 2005 [eu467]
MARKER RELATIONSHIPS
eu467 Is Encoded by: [Gene] ptch2 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:DU644707 408 bp
OTHER eu467 EST PAGES No links to external sites
CITATIONS (1)