ZFIN ID: ZDB-EST-060130-1
EST Name: eu230
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 225
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer CAGAGCAGCACAGAAGTGAG                reverse_primer GGATCCATTAACCCTCACTAAAGGGAACTCCACAGCGGAGTGTG
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2005 [eu230]
MARKER RELATIONSHIPS
eu230 Is Encoded by: [Gene] mitfb (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:DU730967 305bp
OTHER eu230 EST PAGESNo links to external sites
CITATIONS (1)