header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-051107-14
EST Name: eu244
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 242
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer TTGATGAAACCCTGCTGTAG
reverse_primer GGATCCATTAACCCTCACTAAAGGGAATTGCATGGTGATGAGTAAGAG
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
Note: TALE homeodomain transcription factor Prep2. [Source:RefSeq;Acc:NM_153654]
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2005 [eu244]
MARKER RELATIONSHIPS
eu244 Is Encoded by: [Gene] pknox2 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:DU644594 328 bp
OTHER eu244 EST PAGES No links to external sites
CITATIONS (1)