ZFIN ID: ZDB-CRISPR-191009-75
CRISPR Name: CRISPR2-itgb1a
Target: itgb1a (1)
Source:
Target Sequence:
5' - GGCAATGGCTCCTTTGAGTGCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-itgb1a No data available
GENOMIC FEATURES CREATED WITH CRISPR2-itgb1a No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-itgb1a No data available
PHENOTYPE
Phenotype resulting from CRISPR2-itgb1a
No data available

Phenotype of all Fish created by or utilizing CRISPR2-itgb1a
Phenotype Fish Conditions Figures
outer limiting membrane broken, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Table S4 from Charlton-Perkins et al., 2019
Muller cell glial cell projection overlap with Muller cell glial cell projection, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Table S4 from Charlton-Perkins et al., 2019
Muller cell physical object quality, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Figure 4 with imageTable S4 from Charlton-Perkins et al., 2019
Muller cell cell body spatial pattern, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Figure 4 with image from Charlton-Perkins et al., 2019
outer limiting membrane morphology, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Figure 4 with image from Charlton-Perkins et al., 2019
Muller cell cell body position, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Figure 4 with image from Charlton-Perkins et al., 2019
inner limiting membrane broken, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Table S4 from Charlton-Perkins et al., 2019
Muller cell glial limiting end-foot decreased amount, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Table S4 from Charlton-Perkins et al., 2019
inner limiting membrane morphology, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Figure 4 with image from Charlton-Perkins et al., 2019
Muller cell cell body displaced, abnormal mi2001Tg + CRISPR1-itgb1a + CRISPR2-itgb1a standard conditions Table S4 from Charlton-Perkins et al., 2019
Genome Resources:
CITATIONS (1)