ZFIN ID: ZDB-CRISPR-191009-106
CRISPR Name: CRISPR1-tuba8l3,tuba8l5
Targets: tuba8l3 (1), tuba8l5 (1)
Source:
Target Sequence:
5' - GGACTTCTTGCCATAGTCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-tuba8l3,tuba8l5 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-tuba8l3,tuba8l5 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-tuba8l3,tuba8l5 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-tuba8l3,tuba8l5
No data available

Phenotype of all Fish created by or utilizing CRISPR1-tuba8l3,tuba8l5
No data available
Genome Resources:
CITATIONS (1)