ZFIN ID: ZDB-CRISPR-190315-3
CRISPR Name: CRISPR1-pygo1
Target: pygo1 (1)
Source:
Target Sequence:
5' - GGACTTCCCAGTAGCAGCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-pygo1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-pygo1
Genomic Feature Affected Genomic Regions    
zh716 pygo1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-pygo1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-pygo1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-pygo1
No data available
OTHER CRISPR1-pygo1 CRISPR PAGESNo links to external sites
CITATIONS (2)