ZFIN ID: ZDB-CRISPR-190218-3
CRISPR Name: CRISPR1-optn
Target: optn (1)
Source:
Target Sequence:
5' - GCTGGAAAAAAGTGGAGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-optn No data available
GENOMIC FEATURES CREATED WITH CRISPR1-optn
Genomic Feature Affected Genomic Regions    
ibl51 optn    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-optn No data available
PHENOTYPE
Phenotype resulting from CRISPR1-optn
No data available

Phenotype of all Fish created by or utilizing CRISPR1-optn
No data available
OTHER CRISPR1-optn CRISPR PAGESNo links to external sites
CITATIONS (1)