ZFIN ID: ZDB-CRISPR-190116-1
CRISPR Name: CRISPR2-rb1
Target: rb1 (1)
Source:
Target Sequence:
5' - GGCTCAGTGAGTTTGAACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-rb1 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-rb1No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-rb1 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-rb1
No data available

Phenotype of all Fish created by or utilizing CRISPR2-rb1
No data available
OTHER CRISPR2-rb1 CRISPR PAGESNo links to external sites
CITATIONS (1)