CRISPR

CRISPR1-gabra1

ID
ZDB-CRISPR-190104-2
Name
CRISPR1-gabra1
Previous Names
None
Target
Sequence
5' - GCCGTTGTGGAAGAACGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
udm103 gabra1
Expression
Gene expression in Wild Types + CRISPR1-gabra1
No data available
Phenotype
Phenotype resulting from CRISPR1-gabra1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gabra1
Phenotype Fish Conditions Figures
brain kif5bb expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
brain nlgn4xb expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
hindbrain postsynaptic density Ab6-gphn labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
hindbrain GABA-ergic synapse Ab6-gphn labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
spinal cord GABAergic neuron ab1-gad labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
hindbrain postsynaptic density Ab6-gphn labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
optic tectum GABAergic neuron ab1-gad labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
brain si:ch1073-425j19.2 expression increased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
startle response increased magnitude, abnormal gabra1udm103/udm103 standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Samarut et al., 2018
startle response magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: carbamazepine Fig. 4 with image from Samarut et al., 2018
brain gabrg2 expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
hindbrain GABAergic neuron ab1-gad labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
response to light stimulus increased magnitude, abnormal gabra1udm103/udm103 standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Samarut et al., 2018
brain hnrnpa0a expression increased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
involuntary skeletal muscle contraction occurrence, ameliorated gabra1udm103/udm103 chemical treatment by environment: levetiracetam Fig. 4 with image from Samarut et al., 2018
response to light stimulus magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: valproic acid Fig. 4 with image from Samarut et al., 2018
spinal cord has fewer parts of type spinal cord inhibitory synapse, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
brain nxph2a expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
hindbrain GABA-ergic synapse Ab6-gphn labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
brain gabbr2 expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
telencephalon has fewer parts of type telencephalon inhibitory synapse, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
brain klc1a expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
hindbrain GABAergic neuron ab1-gad labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
involuntary skeletal muscle contraction occurrence, ameliorated gabra1udm103/udm103 chemical treatment by environment: valproic acid Fig. 4 with image from Samarut et al., 2018
brain nlgn2b expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
optic tectum GABAergic neuron ab1-gad labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
swimming decreased occurrence, abnormal gabra1udm103/udm103 standard conditions Fig. 2 with image from Samarut et al., 2018
brain pho expression increased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
startle response magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: valproic acid Fig. 4 with image from Samarut et al., 2018
startle response magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: clonazepam Fig. 4 with image from Samarut et al., 2018
brain slc6a11b expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
brain rnf121 expression increased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
motor behavior process quality, abnormal gabra1udm103/udm103 control Fig. 2 from Liao et al., 2019
response to light stimulus magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: carbamazepine Fig. 4 with image from Samarut et al., 2018
GABAergic neuron inhibitory synapse assembly decreased occurrence, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
involuntary skeletal muscle contraction occurrence, ameliorated gabra1udm103/udm103 chemical treatment by environment: clonazepam Fig. 4 with image from Samarut et al., 2018
brain kcnk5a expression increased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
brain gabra1 expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 1 with imageFig. 5 with image from Samarut et al., 2018
spinal cord GABAergic neuron ab1-gad labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
response to light stimulus magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: levetiracetam Fig. 4 with image from Samarut et al., 2018
brain gabbr1b expression decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 5 with image from Samarut et al., 2018
telencephalon GABAergic neuron ab1-gad labeling decreased amount, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
hindbrain has fewer parts of type hindbrain inhibitory synapse, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
optic tectum has fewer parts of type optic tectum inhibitory synapse, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
involuntary skeletal muscle contraction increased occurrence, abnormal gabra1udm103/udm103 standard conditions Fig. 2 with imageFig. 4 with image from Samarut et al., 2018
response to light stimulus magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: clonazepam Fig. 4 with image from Samarut et al., 2018
startle response magnitude, ameliorated gabra1udm103/udm103 chemical treatment by environment: levetiracetam Fig. 4 with image from Samarut et al., 2018
telencephalon GABAergic neuron ab1-gad labeling decreased distribution, abnormal gabra1udm103/udm103 standard conditions Fig. 6 with image from Samarut et al., 2018
phototaxis increased process quality, abnormal gabra1udm103/udm103 control Fig. 2 from Liao et al., 2019
involuntary skeletal muscle contraction occurrence, ameliorated gabra1udm103/udm103 chemical treatment by environment: carbamazepine Fig. 4 with image from Samarut et al., 2018
brain gabra1 expression decreased amount, abnormal gabra1udm103/+ standard conditions Fig. 1 with image from Samarut et al., 2018
optic tectum membrane depolarization during action potential occurrence, ameliorated gabra1udm103/udm103; icm05Tg chemical treatment by environment: valproic acid Fig. 3 with image from Samarut et al., 2018
optic tectum cellular response to light stimulus occurrence, ameliorated gabra1udm103/udm103; icm05Tg chemical treatment by environment: valproic acid Fig. 3 with image from Samarut et al., 2018
optic tectum membrane depolarization during action potential increased occurrence, abnormal gabra1udm103/udm103; icm05Tg standard conditions Fig. 3 with image from Samarut et al., 2018
optic tectum cellular response to light stimulus increased occurrence, abnormal gabra1udm103/udm103; icm05Tg standard conditions Fig. 3 with image from Samarut et al., 2018
optic tectum has fewer parts of type optic tectum inhibitory synapse, abnormal gabra1udm103/udm103; ot1Tg standard conditions Fig. 6 with image from Samarut et al., 2018
telencephalon has fewer parts of type telencephalon inhibitory synapse, abnormal gabra1udm103/udm103; ot1Tg standard conditions Fig. 6 with image from Samarut et al., 2018
hindbrain has fewer parts of type hindbrain inhibitory synapse, abnormal gabra1udm103/udm103; ot1Tg standard conditions Fig. 6 with image from Samarut et al., 2018
GABAergic neuron inhibitory synapse assembly decreased occurrence, abnormal gabra1udm103/udm103; ot1Tg standard conditions Fig. 6 with image from Samarut et al., 2018
spinal cord has fewer parts of type spinal cord inhibitory synapse, abnormal gabra1udm103/udm103; ot1Tg standard conditions Fig. 6 with image from Samarut et al., 2018
Citations