CRISPR

CRISPR1-esrp2

ID
ZDB-CRISPR-181219-2
Name
CRISPR1-esrp2
Previous Names
None
Target
Sequence
5' - GGAGACCGGGCTCACTGCCGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
crg2 esrp2
Expression
Gene expression in Wild Types + CRISPR1-esrp2
No data available
Phenotype
Phenotype resulting from CRISPR1-esrp2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-esrp2
Phenotype Fish Conditions Figures
whole organism esrp2 expression decreased amount, abnormal esrp2crg2/crg2 standard conditions Fig. S3 with image from Burguera et al., 2017
esophagus structure, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
whole organism Ab1-esrp1 labeling decreased amount, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
swim bladder inflation decreased occurrence, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
mRNA processing process quality, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 5Fig. 6 with image from Burguera et al., 2017
inner ear decreased volume, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
mRNA splicing, via spliceosome process quality, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 5Fig. 6 with image from Burguera et al., 2017
whole organism decreased life span, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions text only from Burguera et al., 2017
whole organism esrp2 expression decreased amount, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
whole organism Ab1-esrp2 labeling decreased amount, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
whole organism dead, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions text only from Burguera et al., 2017
whole organism esrp1 expression decreased amount, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
basibranchial position, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
pectoral fin morphology, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
esophagus decreased diameter, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
dorsolateral septum structure, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
mesethmoid bone morphology, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
swim bladder epithelium increased thickness, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
ethmoid cartilage split, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
pectoral fin endoskeletal disc malformed, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
swim bladder epithelium decreased size, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. S3 with image from Burguera et al., 2017
olfactory epithelium morphology, abnormal esrp2crg2/crg2; esrp1crg1/crg1 standard conditions Fig. 1 with image from Burguera et al., 2017
Citations