ZFIN ID: ZDB-CRISPR-181119-260
CRISPR Name: CRISPR4-myh9a
Target: myh9a (2)
Previous Name: Z001679 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGCGTTGATCGTGTTGCGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-myh9a No data available
GENOMIC FEATURES CREATED WITH CRISPR4-myh9aNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-myh9a No data available
PHENOTYPE
Phenotype resulting from CRISPR4-myh9a
No data available

Phenotype of all Fish created by or utilizing CRISPR4-myh9a
No data available
OTHER CRISPR4-myh9a CRISPR PAGES
  • CRISPRz:Z001679 (1)
  • CITATIONS (2)