header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-181119-237
CRISPR Name: CRISPR3-twist1b
Target: twist1b (2)
Previous Name: Z001656 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGTTATCGGAAGGTAAAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-twist1b No data available
GENOMIC FEATURES CREATED WITH CRISPR3-twist1b No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-twist1b No data available
PHENOTYPE
Phenotype resulting from CRISPR3-twist1b
No data available

Phenotype of all Fish created by or utilizing CRISPR3-twist1b
No data available
Genome Resources: CRISPRz:Z001656 (1)
CITATIONS (2)