CRISPR

CRISPR1-pitpnc1a

ID
ZDB-CRISPR-181109-1
Name
CRISPR1-pitpnc1a
Previous Names
None
Target
Sequence
5' - ACCACGGCTCGCGCCCAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
u506 pitpnc1a
Expression
Gene expression in Wild Types + CRISPR1-pitpnc1a
No data available
Phenotype
Phenotype resulting from CRISPR1-pitpnc1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pitpnc1a
Phenotype Fish Conditions Figures
diencephalon dopaminergic neuron ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
brain fosab expression amount, ameliorated pitpnc1au506/u506 (AB/TL) constant dark, chemical treatment by environment: LY294002 Fig. 4 with image from Ashlin et al., 2018
musculoskeletal movement increased occurrence, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 2 with image from Ashlin et al., 2018
preoptic area fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
cerebellum fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
hypothalamus posterior region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
forebrain dorsal region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
thigmotaxis increased occurrence, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 2 with image from Ashlin et al., 2018
brain fosab expression amount, ameliorated pitpnc1au506/u506 (AB/TL) constant dark, chemical treatment by environment: MK-2206 Fig. 4 with image from Ashlin et al., 2018
preoptic area fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
midbrain ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
hypothalamus ventral region Ab3-igf1r labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
preoptic area fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
hypothalamus posterior region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
hypothalamus posterior region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
superior raphe nucleus ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
insulin-like growth factor receptor signaling pathway increased occurrence, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
forebrain dorsal region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
forebrain dorsal region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
optic tectum ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
forebrain ventral region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
locus coeruleus ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
midbrain fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
hindbrain ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
circadian sleep/wake cycle, wakefulness increased occurrence, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
circadian sleep/wake cycle, wakefulness occurrence, ameliorated pitpnc1au506/u506 (AB/TL) chemical treatment by environment: MK-2206 Fig. 4 with image from Ashlin et al., 2018
forebrain ventral region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
midbrain fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
brain pitpnc1a expression absent, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 2 with image from Ashlin et al., 2018
dorsal telencephalon Ab3-igf1r labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
brain fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 4 with image from Ashlin et al., 2018
hindbrain fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
cerebellum fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant dark Fig. 3 with image from Ashlin et al., 2018
midbrain fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
forebrain ventral region fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
forebrain ventral region ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
dorsal telencephalon Ab3-igf1r labeling increased distribution, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
cerebellum fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) constant light Fig. 3 with image from Ashlin et al., 2018
optic tectum fosab expression increased amount, abnormal pitpnc1au506/u506 (AB/TL) altered light dark cycle Fig. 3 with image from Ashlin et al., 2018
forebrain dorsal region ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
hypothalamus ventral region Ab3-igf1r labeling increased distribution, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 4 with image from Ashlin et al., 2018
hypothalamus hypocretin-secreting neuron ab9-mapk labeling increased amount, abnormal pitpnc1au506/u506 (AB/TL) standard conditions Fig. 3 with image from Ashlin et al., 2018
brain pitpnc1a expression decreased amount, abnormal pitpnc1au506/+ (AB/TL) standard conditions Fig. 2 with image from Ashlin et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.