header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-181019-4
CRISPR Name: CRISPR1-rb1
Target: rb1 (1)
Source:
Target Sequence:
5' - GGAGAGGGAGATCAGATCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-rb1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-rb1 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-rb1
Expressed Gene Anatomy Figures
ascl1b Fig. 4 from Schultz et al., 2018
hdac1 Fig. 4 from Schultz et al., 2018
olig2 Fig. 4 from Schultz et al., 2018
rbbp4 Fig. 4 from Schultz et al., 2018
PHENOTYPE
Phenotype resulting from CRISPR1-rb1
Phenotype of all Fish created by or utilizing CRISPR1-rb1
Phenotype Fish Conditions Figures
brain ab3-sox10 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
hindbrain neoplastic, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab18-h3 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain Ab2-olig2 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab3-sox10 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ab1-sox2 labeling increased distribution, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain Ab2-olig2 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain ascl1b expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
midbrain neoplastic, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain rbbp4 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain hdac1 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain ab1-sox2 labeling increased amount, abnormal WT + CRISPR1-rb1 control Fig. 1 with image from Schultz et al., 2018
brain olig2 expression increased amount, abnormal WT + CRISPR1-rb1 control Fig. 4 from Schultz et al., 2018
brain mitotic cell cycle increased occurrence, abnormal kca6Tg + CRISPR1-rb1 control Fig. 6 with image from Schultz et al., 2018
brain mitotic cell cycle increased occurrence, abnormal kca66Tg + CRISPR1-rb1 control Fig. 6 with image from Schultz et al., 2018
OTHER CRISPR1-rb1 CRISPR PAGES No links to external sites
CITATIONS (1)