CRISPR

CRISPR1-pik3c3

ID
ZDB-CRISPR-181016-2
Name
CRISPR1-pik3c3
Previous Names
None
Target
Sequence
5' - GGCGACGGCATAGCGTCTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf2160 pik3c3
zf2161 pik3c3
Expression
Gene expression in Wild Types + CRISPR1-pik3c3
No data available
Phenotype
Phenotype resulting from CRISPR1-pik3c3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pik3c3
Phenotype Fish Conditions Figures
whole organism lect2.1 expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism fabp2 expression absent, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 4 with image from Zhao et al., 2018
whole organism mpx expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image,  Fig. 4 with image from Zhao et al., 2018
intestinal epithelium vil1 expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
intestinal epithelial structure maintenance disrupted, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
intestine hnf4a expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelial cell ab1-tjp1 labeling spatial pattern, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 6 with image from Zhao et al., 2018
intestinal epithelial cell ab2-cdh1 labeling spatial pattern, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 6 with image from Zhao et al., 2018
whole organism mpx expression amount, ameliorated pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
whole organism tnfa expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism bent, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
digestion decreased efficacy, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
intestinal bulb lacks parts or has fewer parts of type intestinal villus, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
intestine hp expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism slc15a1b expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
whole organism vil1 expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
intestinal epithelium microvillus absent, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism tnfa expression increased amount, abnormal pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
whole organism card9 expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism cxcl8a expression increased amount, abnormal pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
intestine igfbp1a expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism apoa1a expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
intestine mmp9 expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism prss1 expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
whole organism il1b expression increased amount, abnormal pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
whole organism fabp2 expression absent, abnormal pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
whole organism mmp9 expression increased amount, abnormal pik3c3zf2160/zf2160 germ free Fig. 4 with image from Zhao et al., 2018
whole organism cxcl8a expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism mmp9 expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
intestine ttc7a expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism il1b expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
intestine il1b expression increased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelium adherens junction incomplete structure, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
mid intestine lacks parts or has fewer parts of type intestinal villus, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism fabp2 expression decreased amount, abnormal pik3c3zf2160/zf2160 standard conditions Fig. 2 with image from Zhao et al., 2018
whole organism lect2.1 expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism fabp2 expression absent, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 4 with image from Zhao et al., 2018
whole organism mpx expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image,  Fig. 4 with image from Zhao et al., 2018
intestinal epithelium vil1 expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
intestine hnf4a expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelial cell ab1-tjp1 labeling spatial pattern, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 6 with image from Zhao et al., 2018
whole organism tnfa expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelial cell ab2-cdh1 labeling spatial pattern, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 6 with image from Zhao et al., 2018
whole organism mpx expression amount, ameliorated pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
digestion decreased efficacy, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism bent, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
intestinal bulb lacks parts or has fewer parts of type intestinal villus, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism vil1 expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
intestine hp expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism slc15a1b expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
intestinal epithelium microvillus absent, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism card9 expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism cxcl8a expression increased amount, abnormal pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
intestine fabp2 expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
whole organism tnfa expression increased amount, abnormal pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
intestine igfbp1a expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism apoa1a expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
intestine mmp9 expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism prss1 expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 2 with image from Zhao et al., 2018
whole organism il1b expression increased amount, abnormal pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
whole organism fabp2 expression absent, abnormal pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
whole organism mmp9 expression increased amount, abnormal pik3c3zf2161/zf2161 germ free Fig. 4 with image from Zhao et al., 2018
whole organism cxcl8a expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
whole organism mmp9 expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
intestine ttc7a expression decreased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
intestine il1b expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelium adherens junction incomplete structure, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
whole organism il1b expression increased amount, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 3 with image from Zhao et al., 2018
mid intestine lacks parts or has fewer parts of type intestinal villus, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
intestinal epithelial structure maintenance disrupted, abnormal pik3c3zf2161/zf2161 standard conditions Fig. 1 with image from Zhao et al., 2018
intestinal epithelium has extra parts of type neutrophil, abnormal pik3c3zf2160/zf2160; rj30Tg standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelium has extra parts of type neutrophil, abnormal pik3c3zf2160/zf2160; rj30Tg germ free Fig. 4 with image from Zhao et al., 2018
intestine neutrophil EGFP expression increased amount, abnormal pik3c3zf2160/zf2160; rj30Tg germ free Fig. 4 with image from Zhao et al., 2018
intestine neutrophil EGFP expression increased amount, abnormal pik3c3zf2160/zf2160; rj30Tg standard conditions Fig. 3 with image from Zhao et al., 2018
myotome vesicle EGFP expression decreased amount, abnormal pik3c3zf2160/zf2160; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium morphology, abnormal pik3c3zf2160/zf2160; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium vesicle EGFP expression decreased amount, abnormal pik3c3zf2160/zf2160; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium vesicle decreased amount, abnormal pik3c3zf2160/zf2160; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium has extra parts of type neutrophil, abnormal pik3c3zf2161/zf2161; rj30Tg standard conditions Fig. 3 with image from Zhao et al., 2018
intestinal epithelium has extra parts of type neutrophil, abnormal pik3c3zf2161/zf2161; rj30Tg germ free Fig. 4 with image from Zhao et al., 2018
intestine neutrophil EGFP expression increased amount, abnormal pik3c3zf2161/zf2161; rj30Tg germ free Fig. 4 with image from Zhao et al., 2018
intestine neutrophil EGFP expression increased amount, abnormal pik3c3zf2161/zf2161; rj30Tg standard conditions Fig. 3 with image from Zhao et al., 2018
myotome vesicle EGFP expression decreased amount, abnormal pik3c3zf2161/zf2161; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium morphology, abnormal pik3c3zf2161/zf2161; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium vesicle EGFP expression decreased amount, abnormal pik3c3zf2161/zf2161; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
intestinal epithelium vesicle decreased amount, abnormal pik3c3zf2161/zf2161; zf2159Tg standard conditions Fig. 5 with image from Zhao et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.