ZFIN ID: ZDB-CRISPR-180827-1
CRISPR Name: CRISPR2-npc1
Target: npc1 (1)
Source:
Target Sequence:
5' - CCGGTCCTGCTGTGCCTCTGCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-npc1 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-npc1
Genomic Feature Affected Genomic Regions    
y535 npc1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-npc1 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-npc1
No data available

Phenotype of all Fish created by or utilizing CRISPR2-npc1
Phenotype Fish Conditions Figures
liver npc1 expression absent, abnormal npc1y535/y535 standard conditions Fig. S1 from Tseng et al., 2018
OTHER CRISPR2-npc1 CRISPR PAGESNo links to external sites
CITATIONS (1)