header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180502-1
CRISPR Name: CRISPR1-mstnb
Target: mstnb (1)
Source:
Target Sequence:
5' - GCAGCCTTCCACAGCCACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-mstnb No data available
GENOMIC FEATURES CREATED WITH CRISPR1-mstnb
Genomic Feature Affected Genomic Regions    
cig3 mstnb    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-mstnb No data available
PHENOTYPE
Phenotype resulting from CRISPR1-mstnb
No data available

Phenotype of all Fish created by or utilizing CRISPR1-mstnb
OTHER CRISPR1-mstnb CRISPR PAGESNo links to external sites
CITATIONS (1)