ZFIN ID: ZDB-CRISPR-180213-354
CRISPR Name: CRISPR1-fam13a
Target: fam13a (1)
Source:
Target Sequence:
5' - GGAATTTCAAGGGCCGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-fam13a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-fam13a
Genomic Feature Affected Genomic Regions    
zko982a fam13a    
zko982b fam13a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-fam13a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-fam13a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-fam13a
No data available
OTHER CRISPR1-fam13a CRISPR PAGESNo links to external sites
CITATIONS (1)