ZFIN ID: ZDB-CRISPR-171212-2
CRISPR Name: CRISPR1-dtnbp1a
Target: dtnbp1a (1)
Source:
Target Sequence:
5' - GTGGGTGGCTCTTCATAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-dtnbp1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-dtnbp1a
Genomic Feature Affected Genomic Regions    
ihb819 dtnbp1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-dtnbp1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-dtnbp1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-dtnbp1a
Phenotype Fish Conditions Figures
integument iridophore differentiation decreased occurrence, abnormal dtnbp1aihb819/ihb819 standard conditions Fig. 5 from Chen et al., 2018
eye iridophore differentiation decreased occurrence, abnormal dtnbp1aihb819/ihb819 standard conditions Fig. 5 from Chen et al., 2018
melanocyte Melanin decreased amount, abnormal dtnbp1aihb819/ihb819 standard conditions Fig. 5 from Chen et al., 2018
OTHER CRISPR1-dtnbp1a CRISPR PAGESNo links to external sites
CITATIONS (2)