CRISPR

CRISPR1-fgf24

ID

ZDB-CRISPR-171204-1

Name

CRISPR1-fgf24

Previous Names

None

Target

fgf24 (1)

Sequence

5' - GGCAAGAAGATTAACGCCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uc47	fgf24

Expression

Gene expression in Wild Types + CRISPR1-fgf24

No data available

Phenotype

Phenotype resulting from CRISPR1-fgf24

No data available

Phenotype of all Fish created by or utilizing CRISPR1-fgf24

Phenotype	Fish	Conditions	Figures
gonad primordium somatic cell ab2-mapk labeling absent, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 4 from Leerberg et al., 2017
female organism absent, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Table S2, text only from Leerberg et al., 2017
gonad primordium ab1-lama1 labeling absent, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 7 from Leerberg et al., 2017
immature gonad germ line cell ddx4 expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 2 from Leerberg et al., 2017
gonad primordium somatic cell amh expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 5 from Leerberg et al., 2017
whole organism lacks all parts of type pectoral fin, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	text only from Leerberg et al., 2017
gonad primordium somatic cell nr5a1a expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 5 from Leerberg et al., 2017
gonad primordium somatic cell gata4 expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 5 from Leerberg et al., 2017
gonad primordium somatic cell etv4 expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 4 from Leerberg et al., 2017
gonad primordium germ line cell ddx4 expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 2 from Leerberg et al., 2017
gonad primordium germ line cell ab1-ctnnb labeling decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 8 from Leerberg et al., 2017
gonad primordium somatic cell ab1-ctnnb labeling decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 8 from Leerberg et al., 2017
gonad primordium somatic cell morphology, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 7 from Leerberg et al., 2017
gonad primordium somatic cell cyp19a1a expression decreased amount, abnormal	fgf24^uc47/uc47 (AB)	standard conditions	Fig. 5 from Leerberg et al., 2017
gonad primordium cell population proliferation decreased process quality, abnormal	fgf24^uc47/uc47; uc02Tg	control	Fig. 6 from Leerberg et al., 2017
gonad disorganized, abnormal	fgf24^uc47/uc47; uc02Tg; uc46Tg	standard conditions	Fig. 2 from Leerberg et al., 2017
gonad germ line cell EGFP expression decreased amount, abnormal	fgf24^uc47/uc47; uc02Tg; uc46Tg	standard conditions	Fig. 2 from Leerberg et al., 2017
germ line cell decreased amount, abnormal	fgf24^uc47/uc47; uc02Tg; uc46Tg	standard conditions	Fig. 2 from Leerberg et al., 2017
Sertoli cell absent, abnormal	fgf24^uc47/uc47; uc02Tg; uc46Tg	standard conditions	Fig. 2 from Leerberg et al., 2017
Sertoli cell mCherry expression absent, abnormal	fgf24^uc47/uc47; uc02Tg; uc46Tg	standard conditions	Fig. 2 from Leerberg et al., 2017
female organism absent, abnormal	tp53^zdf1/zdf1; fgf24^uc47/uc47	standard conditions	Table S2 from Leerberg et al., 2017

Citations