header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-171012-1
CRISPR Name: CRISPR1-zic2b
Target: zic2b (1)
Source:
Target Sequence:
5' - GGTGGAGTTAAAAGTGGAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-zic2b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-zic2b
Genomic Feature Affected Genomic Regions    
uw1116 zic2b    
uw1127 zic2b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-zic2b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-zic2b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-zic2b
OTHER CRISPR1-zic2b CRISPR PAGESNo links to external sites
CITATIONS (1)