CRISPR

CRISPR2-narfl

ID

ZDB-CRISPR-170609-8

Name

CRISPR2-narfl

Previous Names

None

Target

narfl (1)

Sequence

5' - GGACATGCAGACGCCAACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb166	narfl

Expression

Gene expression in Wild Types + CRISPR2-narfl

No data available

Phenotype

Phenotype resulting from CRISPR2-narfl

No data available

Phenotype of all Fish created by or utilizing CRISPR2-narfl

Phenotype	Fish	Conditions	Figures
intestine fabp1a expression spatial pattern, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
whole organism bmp16 expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
liver ela2l expression decreased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
whole organism kdr expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
whole organism pdgfrb expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
intestine fabp1a expression decreased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
whole organism aldoca expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
whole organism vegfab expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
whole organism bmp7b expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
superoxide dismutase activity decreased efficacy, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Luo et al., 2019
digestive system compound organ morphology, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
liver ela2l expression spatial pattern, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
glutathione synthase activity decreased efficacy, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Luo et al., 2019
whole organism tek expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
aconitate hydratase activity decreased efficacy, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 1 from Luo et al., 2019
blood vessel development hypertrophic growth, ameliorated	narfl^{ihb166/ihb166}	chemical treatment: 2-methoxy-17beta-estradiol	Fig. 5 from Luo et al., 2019
whole organism angpt1 expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
whole organism bmp2b expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
adenylyl-sulfate reductase (glutathione) activity decreased efficacy, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Luo et al., 2019
whole organism hkdc1 expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
exocrine pancreas fabp2 expression decreased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
subintestinal vein morphology, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Liu et al., 2017
exocrine pancreas fabp2 expression spatial pattern, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 3 from Luo et al., 2019
intestine hif1ab expression increased distribution, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Luo et al., 2019
subintestinal vein sprouting angiogenesis increased occurrence, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Liu et al., 2017
whole organism hif1ab expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 4 from Luo et al., 2019
whole organism gck expression increased amount, abnormal	narfl^{ihb166/ihb166}	standard conditions	Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal	narfl^{ihb166/ihb166}; y1Tg	standard conditions	Fig. 2 from Luo et al., 2019

Citations