header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170106-4
CRISPR Name: CRISPR2-gfap
Target: gfap (1)
Source:
Target Sequence:
5' - GTGCGCAACACATAGCACCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR targets an intron of gfap.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-gfap No data available
GENOMIC FEATURES CREATED WITH CRISPR2-gfap
Genomic Feature Affected Genomic Regions    
ion44Tg gfap    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-gfap No data available
PHENOTYPE
Phenotype resulting from CRISPR2-gfap
No data available

Phenotype of all Fish created by or utilizing CRISPR2-gfap
No data available
OTHER CRISPR2-gfap CRISPR PAGESNo links to external sites
CITATIONS (1)