ZFIN ID: ZDB-CRISPR-161214-631
CRISPR Name: CRISPR5-tbc1d30
Target: tbc1d30 (2)
Previous Name: Z001112 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGGATTTTGAACAGCAGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR5-tbc1d30 No data available
GENOMIC FEATURES CREATED WITH CRISPR5-tbc1d30No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR5-tbc1d30 No data available
PHENOTYPE
Phenotype resulting from CRISPR5-tbc1d30
No data available

Phenotype of all Fish created by or utilizing CRISPR5-tbc1d30
No data available
OTHER CRISPR5-tbc1d30 CRISPR PAGES
  • CRISPRz:Z001112 (1)
  • CITATIONS (2)